shRNA Lentivirus (self-inactivating), pH1-(RSBN1-shRNA-Seq1)(CAT#: LV-SI0574WQ)
This product is a RSBN1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The RSBN1 gene specifically demethylates dimethylated 'Lys-20' of histone H4 (H4K20me2), thereby modulating chromosome architecture. The expression of RSBN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | RSBN1-shRNA-Seq1 |
| Related Target/Protein | RSBN1 |
| Region | CDS |
| TargetSeq | CGATCTCAAGCACAAGGACAA |
| NCBI RefSeq | NM_018364 |
| Alternative Names | KDM9; ROSBIN |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |