shRNA Lentivirus (self-inactivating), pH1-(SELRC1-shRNA-Seq3)(CAT#: LV-SI0808WQ)
This product is a SELRC1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SELRC1 gene is required for assembly of mitochondrial respiratory chain complex I and complex IV. The expression of SELRC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SELRC1-shRNA-Seq3 |
| Related Target/Protein | SELRC1 |
| Region | 3UTR |
| TargetSeq | GCCATCGTCTAGAAGAGACAT |
| NCBI RefSeq | NM_023077 |
| Alternative Names | RESA1; SCAN3; COA7; C1orf163 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Respiratory disease |