shRNA Lentivirus (self-inactivating), pH1-(SERINC5-shRNA-Seq2)(CAT#: LV-SI0998WQ)
This product is a SERINC5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SERINC5 gene impairs the penetration of the viral particle into the cytoplasm and enhances the incorporation of serine into phosphatidylserine and sphingolipids. May play a role in providing serine molecules for the formation of myelin glycosphingolipids in oligodendrocytes. The expression of SERINC5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SERINC5-shRNA-Seq2 |
| Related Target/Protein | SERINC5 |
| Region | CDS |
| TargetSeq | GCAGCTCCTGAATTGGAGATA |
| NCBI RefSeq | NM_178276 |
| Alternative Names | TPO1; C5orf12 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | HIV infection |