shRNA Lentivirus (self-inactivating), pH1-(SH3BP5-shRNA-Seq1)(CAT#: LV-SI0937WQ)
This product is a SH3BP5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SH3BP5 gene functions as guanine nucleotide exchange factor (GEF) with specificity for RAB11A and RAB25. The expression of SH3BP5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SH3BP5-shRNA-Seq1 |
| Related Target/Protein | SH3BP5 |
| Region | CDS |
| TargetSeq | CCTTTGAAGATGACAGCTGTA |
| NCBI RefSeq | NM_004844 |
| Alternative Names | SAB; SH3BP-5 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Acute Liver Failure |
