shRNA Lentivirus (self-inactivating), pH1-(SLC9A11-shRNA-Seq1)(CAT#: LV-SI0626WQ)
This product is a SLC9A11-shRNA encoding Lentivirus, which is based on HIV-1 serotype. SLC9A11 is a member of the sodium-hydrogen exchanger (NHE) family and involved in pH regulation. The expression of SLC9A11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SLC9A11-shRNA-Seq1 |
| Related Target/Protein | SLC9A11 |
| Region | 3UTR |
| TargetSeq | GTCAGGTTAAAGACCAAACTA |
| NCBI RefSeq | NM_178527 |
| Alternative Names | SLC9C2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Endometrial cancer |