shRNA Lentivirus (self-inactivating), pH1-(SLC9A11-shRNA-Seq1)(CAT#: LV-SI0626WQ)

This product is a SLC9A11-shRNA encoding Lentivirus, which is based on HIV-1 serotype. SLC9A11 is a member of the sodium-hydrogen exchanger (NHE) family and involved in pH regulation. The expression of SLC9A11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SLC9A11-shRNA-Seq1
Related Target/Protein SLC9A11
Region 3UTR
TargetSeq GTCAGGTTAAAGACCAAACTA
NCBI RefSeq NM_178527
Alternative Names SLC9C2
Titer >1*10^10 GC/mL
Related Diseases Endometrial cancer
Target Gene
Gene ID 284525
Uniprot ID Q5TAH2

Related Products