shRNA Lentivirus (self-inactivating), pH1-(SPAG17-shRNA-Seq1)(CAT#: LV-SI0722WQ)

This product is a SPAG17-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPAG17 gene encoded protein is required for the proper function of the axoneme. SPAG17 deficiency results in skeletal malformations and bone abnormalities. The expression of SPAG17-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SPAG17-shRNA-Seq1
Related Target/Protein SPAG17
Region CDS
TargetSeq GCCCAACATTACATTATAGTT
NCBI RefSeq NM_206996
Alternative Names PF6; CT143
Titer >1*10^10 GC/mL
Related Diseases Skeletal malformations and bone abnormalities
Target Gene
Gene ID 200162
Uniprot ID Q6Q759

Related Products