shRNA Lentivirus (self-inactivating), pH1-(SPEM1-shRNA-Seq1)(CAT#: LV-SI3037WQ)

Datasheet

This product is a SPEM1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPEM1 gene is required for proper cytoplasm removal during spermatogenesis. The expression of SPEM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SPEM1-shRNA-Seq1
Related Target/Protein SPEM1
Region 3UTR
TargetSeq GTGAACTCAGAAACTGAGAAA
NCBI RefSeq NM_199339
Alternative Names C17orf83
Titer >1*10^10 GC/mL
Target Gene
Gene ID 374768
Uniprot ID Q8N4L4

Related Products

shRNA Lentivirus (self-inactivating), pH1-(Armc5-shRNA-Seq1) (CAT#:LV-SI3184WQ) Recombinant lentivirus, pU6-(Human TBX18), Overexpression (CAT#:Lenti-GTOH0674WQ) Recombinant lentivirus, pU6-(Human STAT1), Overexpression (CAT#:Lenti-GTOH0522WQ) shRNA Lentivirus (self-inactivating), p7SK-(Olfr376-shRNA-Seq5) (CAT#:LV-SI3729WQ) shRNA Lentivirus (self-inactivating), pU6-(GOLM1-shRNA-Seq2) (CAT#:LV-SI0132WQ) shRNA Lentivirus (self-inactivating), pU6-(C3orf52-shRNA-Seq1) (CAT#:LV-SI0271WQ) shRNA Lentivirus (self-inactivating), pH1-(LSM12-shRNA-Seq2) (CAT#:LV-SI0975WQ) shRNA Lentivirus (self-inactivating), pU6-(Atat1-shRNA-Seq1) (CAT#:LV-SI2326WQ)