shRNA Lentivirus (self-inactivating), pH1-(Tatdn1-shRNA-Seq1)(CAT#: LV-SI3073WQ)
This product is a Tatdn1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Tatdn1 gene is putative deoxyribonuclease. The expression of Tatdn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Tatdn1-shRNA-Seq1 |
| Related Target/Protein | Tatdn1 |
| Region | CDS |
| TargetSeq | CAACCTGACAGATCCTATGTT |
| NCBI RefSeq | NM_175151 |
| Alternative Names | CDA11 |
| Titer | >1*10^10 GC/mL |
