shRNA Lentivirus (self-inactivating), pH1-(TDRD7-shRNA-Seq2)(CAT#: LV-SI0848WQ)
This product is a TDRD7-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by TDRD7 gene belongs to the Tudor family of proteins. This protein contains conserved Tudor domains and LOTUS domains. It is a component of RNA granules, which function in RNA processing. Mutations in this gene have been associated with cataract formation in mouse and human. The expression of TDRD7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TDRD7-shRNA-Seq2 |
| Related Target/Protein | TDRD7 |
| Region | 3UTR |
| TargetSeq | CCTTGACAACTAATTCAGATT |
| NCBI RefSeq | NM_014290 |
| Alternative Names | TRAP; CATC4; PCTAIRE2BP |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Congenital cataract and nonobstructive azoospermia |