shRNA Lentivirus (self-inactivating), pH1-(THOC1-shRNA-Seq4)(CAT#: LV-SI0533WQ)
This product is a THOC1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. THOC1, also known as HPR1, is part of the TREX (transcription/export) complex and participate in an apoptotic pathway which is characterized by activation of caspase-6, increases in the expression of BAK1 and BCL2L1 and activation of NF-kappa-B. The expression of THOC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | THOC1-shRNA-Seq4 |
Related Target/Protein | THOC1 |
Region | CDS |
TargetSeq | GTATGTGCAATGATCTCCTAA |
NCBI RefSeq | NM_005131 |
Alternative Names | P84; HPR1; P84N5 |
Titer | >1*10^10 GC/mL |
Related Diseases | Lung cancer, Liver cancer, Breast cancer |