shRNA Lentivirus (self-inactivating), pH1-(THOC1-shRNA-Seq4)(CAT#: LV-SI0533WQ)
This product is a THOC1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. THOC1, also known as HPR1, is part of the TREX (transcription/export) complex and participate in an apoptotic pathway which is characterized by activation of caspase-6, increases in the expression of BAK1 and BCL2L1 and activation of NF-kappa-B. The expression of THOC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | THOC1-shRNA-Seq4 |
| Related Target/Protein | THOC1 |
| Region | CDS |
| TargetSeq | GTATGTGCAATGATCTCCTAA |
| NCBI RefSeq | NM_005131 |
| Alternative Names | P84; HPR1; P84N5 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung cancer, Liver cancer, Breast cancer |