shRNA Lentivirus (self-inactivating), pH1-(TMEM205-shRNA-Seq3)(CAT#: LV-SI0843WQ)
This product is a TMEM205-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Elevated expression of TMEM205, a hypothetical membrane protein, is associated with cisplatin resistance. The expression of TMEM205-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TMEM205-shRNA-Seq3 |
| Related Target/Protein | TMEM205 |
| Region | CDS |
| TargetSeq | CTTCATCAACCTCTGCATCTT |
| NCBI RefSeq | NM_198536 |
| Alternative Names | UNQ501 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Ovarian cancer |