shRNA Lentivirus (self-inactivating), pH1-(Vmn1r9-shRNA-Seq4)(CAT#: LV-SI2915WQ)

This product is a Vmn1r9-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Vmn1r9 gene has pheromone binding and pheromone receptor activity. The expression of Vmn1r9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Vmn1r9-shRNA-Seq4
Related Target/Protein Vmn1r9
Region CDS
TargetSeq CCAATACCTCTTTGATGGCAA
NCBI RefSeq NM_134185
Alternative Names V1rc30
Titer >1*10^10 GC/mL
Target Gene
Gene ID 171203
Uniprot ID A2RST7

Related Products