shRNA Lentivirus (self-inactivating), pH1-(XIRP1-shRNA-Seq1)(CAT#: LV-SI2413WQ)
This product is a XIRP1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by XIRP1 gene is a striated muscle protein and belongs to the Xin actin-binding repeat-containing protein (XIRP) family. The protein functions to protect actin filaments during depolymerization. The expression of XIRP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | XIRP1-shRNA-Seq1 |
| Related Target/Protein | XIRP1 |
| Region | CDS |
| TargetSeq | GAGTCAAGTCAAGATCAGAAA |
| NCBI RefSeq | NM_194293 |
| Alternative Names | Xin; CMYA1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cardiovascular disease |