shRNA Lentivirus (self-inactivating), pH1-(Zc3hav1l-shRNA-Seq4)(CAT#: LV-SI2720WQ)

This product is a Zc3hav1l-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Zc3hav1l-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Zc3hav1l-shRNA-Seq4
Related Target/Protein Zc3hav1l
Region 3UTR
TargetSeq CCCTCTGTGCTGTCATCAATA
NCBI RefSeq NM_172467
Alternative Names C7orf39
Titer >1*10^10 GC/mL
Target Gene
Gene ID 92092
Uniprot ID Q96H79

Related Products