shRNA Lentivirus (self-inactivating), pH1-(ZDHHC15-shRNA-Seq1)(CAT#: LV-SI2995WQ)
This product is a ZDHHC15-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by ZDHHC15 gene belongs to the DHHC palmitoyltransferase family. Mutations in this gene are associated with mental retardatio X-linked type 91 (MRX91). The expression of ZDHHC15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | ZDHHC15-shRNA-Seq1 |
Related Target/Protein | ZDHHC15 |
Region | 3UTR |
TargetSeq | CCATCAAATACTTGCTGTGTA |
NCBI RefSeq | NM_144969 |
Alternative Names | MRX91; DHHC15 |
Titer | >1*10^10 GC/mL |
Related Diseases | Mental retardatio X-linked type 91 (MRX91) |