shRNA Lentivirus (self-inactivating), pH1-(ZDHHC19-shRNA-Seq1)(CAT#: LV-SI0579WQ)

This product is a ZDHHC19-shRNA encoding Lentivirus, which is based on HIV-1 serotype. ZDHHC19 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-cysteine S-palmitoyltransferase activity. The expression of ZDHHC19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert ZDHHC19-shRNA-Seq1
Related Target/Protein ZDHHC19
Region CDS
TargetSeq GCCAGCAACTGGTATTTAACA
NCBI RefSeq NM_144637
Alternative Names DHHC19
Titer >1*10^10 GC/mL
Related Diseases Liver cancer
Target Gene
Gene ID 131540
Uniprot ID Q8WVZ1

Related Products