shRNA Lentivirus (self-inactivating), pH1-(ZNF714-shRNA-Seq1)(CAT#: LV-SI0849WQ)
This product is a ZNF714-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The ZNF714 gene may be involved in transcriptional regulation. The expression of ZNF714-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | ZNF714-shRNA-Seq1 |
Related Target/Protein | ZNF714 |
Region | 3UTR |
TargetSeq | GCCTTTAACAAGCCCTCAATT |
NCBI RefSeq | NM_182515 |
Titer | >1*10^10 GC/mL |
Related Diseases | Type 1 diabetes |