shRNA Lentivirus (self-inactivating), pU6-(9130011J15Rik-shRNA-Seq2)(CAT#: LV-SI1716WQ)

Datasheet

This product is a 9130011J15Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 9130011J15Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 9130011J15Rik-shRNA-Seq2
Related Target/Protein 9130011J15Rik
Region 3UTR
TargetSeq CCTTGCTATAACCAGATATAT
NCBI RefSeq NM_172396
Alternative Names Smim7
Titer >1*10^10 GC/mL
Target Gene
Gene ID 66818
Uniprot ID F8WIU9

Related Products

Recombinant lentivirus, pU6-(Human hsa-miR-514a-3p), Overexpression (CAT#:Lenti-GTOH0500WQ) shRNA Lentivirus (self-inactivating), pH1-(EWSR1-shRNA-Seq3) (CAT#:LV-SI0537WQ) shRNA Lentivirus (self-inactivating), pU6-(C11orf76-shRNA-Seq1) (CAT#:LV-SI0224WQ) Recombinant lentivirus, pU6-(Human hsa-mir-134), Overexpression (CAT#:Lenti-GTOH0309WQ) shRNA Lentivirus (self-inactivating), pU6-(OR5H15-shRNA-Seq1) (CAT#:LV-SI2152WQ) shRNA Lentivirus (self-inactivating), pH1-(OR4X2-shRNA-Seq3) (CAT#:LV-SI2381WQ) Recombinant lentivirus, pU6-(Human MAPT), Overexpression (CAT#:Lenti-GTOH0540WQ) shRNA Lentivirus (self-inactivating), p7SK-(LSM12-shRNA-Seq1) (CAT#:LV-SI1475WQ)