shRNA Lentivirus (self-inactivating), pU6-(A130030D10Rik-shRNA-Seq1)(CAT#: LV-SI2245WQ)
This product is a A130030D10Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by A130030D10Rik gene may play a role in Shh signaling by mediating the ubiquitination of Kif7. The expression of A130030D10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | A130030D10Rik-shRNA-Seq1 |
| Related Target/Protein | A130030D10Rik |
| Region | 3UTR |
| TargetSeq | CGCTAACACTTTGCTGTATTT |
| NCBI RefSeq | NM_177783 |
| Alternative Names | Zfp650; Znf650; AA409735; AA414972; AA422631; AI646861; AU016126; 1110059H15Rik; 4833421P10Rik; Ubr3 |
| Titer | >1*10^10 GC/mL |
