shRNA Lentivirus (self-inactivating), pU6-(ARMC4-shRNA-Seq1)(CAT#: LV-SI0087WQ)
This product is a ARMC4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The ARMC4 gene encoded protein contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. The expression of ARMC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | ARMC4-shRNA-Seq1 |
| Related Target/Protein | ARMC4 |
| Region | 3UTR |
| TargetSeq | GTTGTTAGCAAACCCTTTCAA |
| NCBI RefSeq | NM_018076 |
| Alternative Names | CILD23 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Primary ciliary dyskensia (PCD) |