shRNA Lentivirus (self-inactivating), pU6-(Atxn7l1-shRNA-Seq4)(CAT#: LV-SI1859WQ)

Datasheet

This product is a Atxn7l1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Atxn7l1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Atxn7l1-shRNA-Seq4
Related Target/Protein Atxn7l1
Region 3UTR
TargetSeq CCTTTAGTCCTCACAACAAAC
NCBI RefSeq NM_001033436
Alternative Names ATXN7L4
Titer >1*10^10 GC/mL
Target Gene
Gene ID 222255
Uniprot ID Q9ULK2

Related Products

shRNA Lentivirus (self-inactivating), p7SK-(OR10A7-shRNA-Seq2) (CAT#:LV-SI3288WQ) shRNA Lentivirus (self-inactivating), pU6-(KLHL7-shRNA-Seq1) (CAT#:LV-SI0062WQ) shRNA Lentivirus (self-inactivating), pU6-(CCDC11-shRNA-Seq3) (CAT#:LV-SI0484WQ) shRNA Lentivirus (self-inactivating), pH1-(4930447C04Rik-shRNA-Seq3) (CAT#:LV-SI2714WQ) Recombinant lentivirus, pU6-(Human PCA3), Overexpression (CAT#:Lenti-GTOH0410WQ) Recombinant lentivirus, pU6-(Human hsa-mir-30d), Overexpression (CAT#:Lenti-GTOH0381WQ) shRNA Lentivirus (self-inactivating), p7SK-(OR5B3-shRNA-Seq5) (CAT#:LV-SI3822WQ) Recombinant lentivirus, pU6-(Mouse NPY), Overexpression (CAT#:Lenti-GTOH0618WQ)