shRNA Lentivirus (self-inactivating), pU6-(BEST1-shRNA-Seq1)(CAT#: LV-SI0235WQ)
This product is a BEST1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The BEST1 gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. The expression of BEST1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | BEST1-shRNA-Seq1 |
| Related Target/Protein | BEST1 |
| Region | CDS |
| TargetSeq | GACTCTGTATTGCGACAGCTA |
| NCBI RefSeq | NM_004183 |
| Alternative Names | ARB; BMD; BEST; RP50; VMD2; TU15B; Best1V1Delta2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Macular Dystrophy |