shRNA Lentivirus (self-inactivating), pU6-(Bex2-shRNA-Seq1)(CAT#: LV-SI2238WQ)
This product is a Bex2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Bex2 gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. The expression of Bex2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Bex2-shRNA-Seq1 |
| Related Target/Protein | Bex2 |
| Region | 3UTR |
| TargetSeq | GTTTGTGATGTACTGTTGTAA |
| NCBI RefSeq | NM_009749 |
| Alternative Names | BEX1; DJ79P11.1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |