shRNA Lentivirus (self-inactivating), pU6-(C12orf32-shRNA-Seq2)(CAT#: LV-SI0399WQ)

This product is a C12orf32-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C12orf32 gene plays a role in DNA damage response (DDR) signaling upon genotoxic stresses such as ionizing radiation (IR) during the S phase. The expression of C12orf32-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C12orf32-shRNA-Seq2
Related Target/Protein C12orf32
Region CDS
TargetSeq CCCGAGGACAAGTATGGAATA
NCBI RefSeq NM_031465
Alternative Names RHINO; RHNO1; HKMT1188
Titer >1*10^10 GC/mL
Related Diseases DNA damage response (DDR)
Target Gene
Gene ID 83695
Uniprot ID Q9BSD3

Related Products