shRNA Lentivirus (self-inactivating), pU6-(C14orf70-shRNA-Seq3)(CAT#: LV-SI0490WQ)
This product is a C14orf70-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C14orf70-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C14orf70-shRNA-Seq3 |
| Related Target/Protein | C14orf70 |
| Region | 3UTR |
| TargetSeq | GAGCTCAGAAAGCTAAAGCAA |
| NCBI RefSeq | NM_001007560 |
| Alternative Names | LINC00523 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Type 2 diabetes |