shRNA Lentivirus (self-inactivating), pU6-(C16orf62-shRNA-Seq3)(CAT#: LV-SI0487WQ)
This product is a C16orf62-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C16orf62 gene acts as component of the retriever complex. The expression of C16orf62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C16orf62-shRNA-Seq3 |
Related Target/Protein | C16orf62 |
Region | CDS |
TargetSeq | CATAGACAAAGTGGACTCCAA |
NCBI RefSeq | NM_020314 |
Alternative Names | VPS35L |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular carcinoma |