shRNA Lentivirus (self-inactivating), pU6-(C1orf180-shRNA-Seq3)(CAT#: LV-SI0384WQ)

This product is a C1orf180-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C1orf180-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C1orf180-shRNA-Seq3
Related Target/Protein C1orf180
Region 3UTR
TargetSeq CCTGCAAGTATCCAGAGAGTT
NCBI RefSeq NM_001033660
Alternative Names LINC01555
Titer >1*10^10 GC/mL
Target Gene
Gene ID 439927
Uniprot ID Q8NAE3

Related Products