shRNA Lentivirus (self-inactivating), pU6-(C1orf212-shRNA-Seq1)(CAT#: LV-SI0290WQ)

This product is a C1orf212-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C1orf212-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C1orf212-shRNA-Seq1
Related Target/Protein C1orf212
Region CDS
TargetSeq GAGAGTTATGAGATGAACATT
NCBI RefSeq NM_138428
Alternative Names SMIM12
Titer >1*10^10 GC/mL
Target Gene
Gene ID 113444
Uniprot ID Q96EX1

Related Products