shRNA Lentivirus (self-inactivating), pU6-(C1QL4-shRNA-Seq1)(CAT#: LV-SI0434WQ)
This product is a C1QL4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C1QL4 gene may regulate the number of excitatory synapses that are formed on hippocampus neurons. The expression of C1QL4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C1QL4-shRNA-Seq1 |
Related Target/Protein | C1QL4 |
Region | CDS |
TargetSeq | CCAACAAGTACAGCACCTTCT |
NCBI RefSeq | NM_001008223 |
Alternative Names | CTRP11; C1QTNF11 |
Titer | >1*10^10 GC/mL |
Related Diseases | Coronary artery disease |