shRNA Lentivirus (self-inactivating), pU6-(C1qtnf3-shRNA-Seq4)(CAT#: LV-SI1874WQ)

This product is a C1qtnf3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C1qtnf3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C1qtnf3-shRNA-Seq4
Related Target/Protein C1qtnf3
Region 3UTR
TargetSeq GCTGATATAGTACAGAAGTTA
NCBI RefSeq NM_030888
Alternative Names CORS; CORCS; CTRP3; CORS26; C1ATNF3; CORS-26
Titer >1*10^10 GC/mL
Target Gene
Gene ID 114899
Uniprot ID Q9BXJ4

Related Products