shRNA Lentivirus (self-inactivating), pU6-(C21orf93-shRNA-Seq2)(CAT#: LV-SI0254WQ)

This product is a C21orf93-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C21orf93-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C21orf93-shRNA-Seq2
Related Target/Protein C21orf93
Region 3UTR
TargetSeq CCTTCTCCTATCCGGAAAGTA
NCBI RefSeq NM_145179
Alternative Names NCRNA00315; LINC00315
Titer >1*10^10 GC/mL
Target Gene
Gene ID 246704
Uniprot ID P59091

Related Products