shRNA Lentivirus (self-inactivating), pU6-(C5orf13-shRNA-Seq1)(CAT#: LV-SI0456WQ)
This product is a C5orf13-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C5orf13 gene may have roles in neural function and cellular differentiation. The expression of C5orf13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C5orf13-shRNA-Seq1 |
Related Target/Protein | C5orf13 |
Region | CDS |
TargetSeq | CCATTTCCAAACAAGGACATG |
NCBI RefSeq | NM_004772 |
Alternative Names | P311; PTZ17; SEZ17; D4S114; NREP; PRO1873 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast Cancer |