shRNA Lentivirus (self-inactivating), pU6-(C7orf42-shRNA-Seq2)(CAT#: LV-SI0336WQ)

This product is a C7orf42-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C7orf42-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C7orf42-shRNA-Seq2
Related Target/Protein C7orf42
Region CDS
TargetSeq GCATCTCATGCACACCAGTTA
NCBI RefSeq NM_017994
Alternative Names TMEM248
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55069
Uniprot ID Q9NWD8

Related Products