shRNA Lentivirus (self-inactivating), pU6-(C7orf64-shRNA-Seq2)(CAT#: LV-SI0324WQ)

This product is a C7orf64-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C7orf64-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C7orf64-shRNA-Seq2
Related Target/Protein C7orf64
Region CDS
TargetSeq CGGCATAAACTTAAAGAGGTA
NCBI RefSeq NM_032120
Alternative Names RBM48; HSPC304
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84060
Uniprot ID Q5RL73

Related Products