shRNA Lentivirus (self-inactivating), pU6-(C9orf23-shRNA-Seq3)(CAT#: LV-SI0319WQ)
This product is a C9orf23-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C9orf23 gene encodes a protein that appears to belong to a family of evolutionarily related proteins (DUF78), that may share one or more domains in common. The expression of C9orf23-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C9orf23-shRNA-Seq3 |
| Related Target/Protein | C9orf23 |
| Region | CDS |
| TargetSeq | CCAAGCTACGTTTCCTTCAGA |
| NCBI RefSeq | NM_148178 |
| Alternative Names | RPP25L; bA296L22.5 |
| Titer | >1*10^10 GC/mL |