shRNA Lentivirus (self-inactivating), pU6-(CCDC80-shRNA-Seq2)(CAT#: LV-SI0492WQ)
This product is a CCDC80-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CCDC80 gene promotes cell adhesion and matrix assembly. The expression of CCDC80-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CCDC80-shRNA-Seq2 |
| Related Target/Protein | CCDC80 |
| Region | CDS |
| TargetSeq | GAGTGTTAGAACTGTTCCCAA |
| NCBI RefSeq | NM_199511 |
| Alternative Names | CL2; URB; DRO1; SSG1; okuribin |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Metabolic disease |