shRNA Lentivirus (self-inactivating), pU6-(CCT3-shRNA-Seq3)(CAT#: LV-SI2104WQ)
This product is a CCT3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by CCT3 gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). The expression of CCT3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | CCT3-shRNA-Seq3 |
Related Target/Protein | CCT3 |
Region | CDS |
TargetSeq | GTGTAAATGGTGAGACGGGTA |
NCBI RefSeq | NM_005998 |
Alternative Names | CCTG; PIG48; TRIC5; CCT-gamma; TCP-1-gamma |
Titer | >1*10^10 GC/mL |