shRNA Lentivirus (self-inactivating), pU6-(Cenpc1-shRNA-Seq5)(CAT#: LV-SI1743WQ)
This product is a Cenpc1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Cenpc1 gene is a centromere autoantigen and a component of the inner kinetochore plate. The encoded protein is required for maintaining proper kinetochore size and a timely transition to anaphase. The expression of Cenpc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Cenpc1-shRNA-Seq5 |
| Related Target/Protein | Cenpc1 |
| Region | 3UTR |
| TargetSeq | GTTAATCATTTCGTACTCCTT |
| NCBI RefSeq | NM_007683 |
| Alternative Names | MIF2; hcp-4; CENP-C; CENPC |
| Titer | >1*10^10 GC/mL |