shRNA Lentivirus (self-inactivating), pU6-(CIAPIN1-shRNA-Seq2)(CAT#: LV-SI0275WQ)
This product is a CIAPIN1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 or CASP families. The expression of CIAPIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CIAPIN1-shRNA-Seq2 |
| Related Target/Protein | CIAPIN1 |
| Region | 3UTR |
| TargetSeq | GCAGAACTCTGAACGACAATA |
| NCBI RefSeq | NM_020313 |
| Alternative Names | DRE2; CIAE2; PRO0915; Anamorsin |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatocellular Carcinoma |
