shRNA Lentivirus (self-inactivating), pU6-(CXXC4-shRNA-Seq1)(CAT#: LV-SI0174WQ)
This product is a CXXC4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CXXC4 gene encodes a CXXC-type zinc finger domain-containing protein that functions as an antagonist of the canonical wingless/integrated signaling pathway. The expression of CXXC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CXXC4-shRNA-Seq1 |
| Related Target/Protein | CXXC4 |
| Region | CDS |
| TargetSeq | CCGTCGTTGCAAATGGCAAAT |
| NCBI RefSeq | NM_025212 |
| Alternative Names | IDAX |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Renal carcinoma |
