shRNA Lentivirus (self-inactivating), pU6-(Cyhr1-shRNA-Seq1)(CAT#: LV-SI2348WQ)

This product is a 1700120K04Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 1700120K04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Cyhr1-shRNA-Seq1
Related Target/Protein Cyhr1
Region CDS
TargetSeq GCAGCTCTACAACAGCATCTT
NCBI RefSeq NM_019396
Alternative Names CHRP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 50626
Uniprot ID Q6ZMK1

Related Products