shRNA Lentivirus (self-inactivating), pU6-(DDX10-shRNA-Seq1)(CAT#: LV-SI0147WQ)
This product is a DDX10-shRNA encoding Lentivirus, which is based on HIV-1 serotype. DDX10 gene is implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. The expression of DDX10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | DDX10-shRNA-Seq1 |
| Related Target/Protein | DDX10 |
| Region | CDS |
| TargetSeq | CCAGTGCTGGAAGCCTTATAT |
| NCBI RefSeq | NM_004398 |
| Alternative Names | Dbp4; HRH-J8 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Myeloid malignancies |