shRNA Lentivirus (self-inactivating), pU6-(DDX10-shRNA-Seq2)(CAT#: LV-SI0148WQ)

This product is a DDX10-shRNA encoding Lentivirus, which is based on HIV-1 serotype. DDX10 gene is implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. The expression of DDX10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert DDX10-shRNA-Seq2
Related Target/Protein DDX10
Region CDS
TargetSeq CCGATAAAGTAATTGAGCCAA
NCBI RefSeq NM_004398
Alternative Names Dbp4; HRH-J8
Titer >1*10^10 GC/mL
Related Diseases Myeloid malignancies
Target Gene
Gene ID 1662
Uniprot ID Q13206

Related Products