shRNA Lentivirus (self-inactivating), pU6-(DEPDC1-shRNA-Seq1)(CAT#: LV-SI0064WQ)
This product is a DEPDC1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The DEPDC1 gene may be involved in transcriptional regulation as a transcriptional corepressor. The expression of DEPDC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | DEPDC1-shRNA-Seq1 |
| Related Target/Protein | DEPDC1 |
| Region | CDS |
| TargetSeq | GAGATGGACTATTTGCTCCTT |
| NCBI RefSeq | NM_017779 |
| Alternative Names | DEP.8; SDP35; DEPDC1A; DEPDC1-V2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Bladder cancer |