shRNA Lentivirus (self-inactivating), pU6-(DHX8-shRNA-Seq2)(CAT#: LV-SI0026WQ)
This product is a DHX8-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by DHX8 gene contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus.The expression of DHX8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | DHX8-shRNA-Seq2 |
| Related Target/Protein | DHX8 |
| Region | CDS |
| TargetSeq | AGACAGAGATAGGGAACGAAA |
| NCBI RefSeq | NM_004941 |
| Alternative Names | DDX8; Dhr2; HRH1; PRP22; PRPF22 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | HIV infection |