shRNA Lentivirus (self-inactivating), pU6-(EWSR1-shRNA-Seq3)(CAT#: LV-SI0036WQ)
This product is a EWSR1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The EWSR1 gene encodes a multifunctional protein that is involved in various cellular processes, including gene expression, cell signaling, and RNA processing and transport. The expression of EWSR1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | EWSR1-shRNA-Seq3 |
| Related Target/Protein | EWSR1 |
| Region | CDS |
| TargetSeq | GACCGCCTATGCAACTTCTTA |
| NCBI RefSeq | NM_005243 |
| Alternative Names | EWS; EWS-FLI1; bK984G1.4 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Ewing sarcoma as well as neuroectodermal tumors |