shRNA Lentivirus (self-inactivating), pU6-(Fads6-shRNA-Seq1)(CAT#: LV-SI2318WQ)
This product is a Fads6-shRNA encoding Lentivirus, which is based on HIV-1 serotype. This protein encoded by Fads6 gene is involved in the pathway fatty acid metabolism, which is part of Lipid metabolism.The expression of Fads6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Fads6-shRNA-Seq1 |
| Related Target/Protein | Fads6 |
| Region | CDS |
| TargetSeq | CATGAATGTGTCAGGCTTCAA |
| NCBI RefSeq | NM_178035 |
| Alternative Names | FP18279 |
| Titer | >1*10^10 GC/mL |