shRNA Lentivirus (self-inactivating), pU6-(Fam166a-shRNA-Seq1)(CAT#: LV-SI1732WQ)
This product is a Fam166a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Fam166a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Fam166a-shRNA-Seq1 |
| Related Target/Protein | Fam166a |
| Region | CDS |
| TargetSeq | CCTTTCTACATGGGCTTTATC |
| NCBI RefSeq | NM_026624 |
| Alternative Names | HSD46 |
| Titer | >1*10^10 GC/mL |