shRNA Lentivirus (self-inactivating), pU6-(FAM23B-shRNA-Seq1)(CAT#: LV-SI0354WQ)
This product is a FAM23B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of FAM23B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | FAM23B-shRNA-Seq1 |
| Related Target/Protein | FAM23B |
| Region | CDS |
| TargetSeq | CCTACCAAGGAACAAGGGCTA |
| NCBI RefSeq | NM_001013629 |
| Alternative Names | FAM23A; TMEM236; bA16O1.2; bA162I21.2 |
| Titer | >1*10^10 GC/mL |
