shRNA Lentivirus (self-inactivating), pU6-(FAM23B-shRNA-Seq1)(CAT#: LV-SI0354WQ)

This product is a FAM23B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of FAM23B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert FAM23B-shRNA-Seq1
Related Target/Protein FAM23B
Region CDS
TargetSeq CCTACCAAGGAACAAGGGCTA
NCBI RefSeq NM_001013629
Alternative Names FAM23A; TMEM236; bA16O1.2; bA162I21.2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 653567
Uniprot ID Q5W0B7

Related Products