shRNA Lentivirus (self-inactivating), pU6-(FAM45B-shRNA-Seq1)(CAT#: LV-SI2193WQ)
This product is a FAM45B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of FAM45B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | FAM45B-shRNA-Seq1 |
| Related Target/Protein | FAM45B |
| Region | 3UTR |
| TargetSeq | CGAAGTGCTATAACTACTTTA |
| NCBI RefSeq | NM_018472 |
| Alternative Names | HT011; DENND10P1; FAM45BP |
| Titer | >1*10^10 GC/mL |
